Super Genius DNA

Chapter 175: GSC (7)



After the press conference, Yoon Bo-Hyun went to the main lobby of the Grand Hyatt Hotel. Scientists who were attending the GSC International Conference were coming down from the floor above for a break.

Yoon Bo-Hyun had also planned this. Reporters swarmed to Young-Joon, fighting to get there first, as he came down into the lobby.

“Doctor Ryu!”

Their countless microphones were aimed towards Young-Joon like they were going to pierce him. Camera flashes fell on his face.

“Please comment on the anthracis in Africa!”

“There is news of the anthracis fence causing an anthrax epidemic in Africa. Is this true?”

“Is it true that you developed the anthrax bioweapon?”

“How do you feel right now!”

“There was an exposé from an insider that you are a murder suspect! Any comments?”

“...”

Young-Joon stayed quiet. His eyes stared past the crowd to the other side where Yoon Bo-Hyun was standing. They stared at each other for a few seconds.

* * *

“What the fxxk is that…”

Park Joo-Hyuk let out a sigh as he watched the TV. Several A-Bio employees were standing in front of the large TV in the break room.

“Oh no…”

“Is that true?”

“Are you kidding?”

“Wait, who’s Yoon Bo-Hyun? Some stupid nobody…”

“I’ve never seen him at A-Gen…”

The employees murmured amongst themselves.

“Mr. Kim,” Cheon Ji-Myung said to Park Joo-Hyuk. “How much do you know about what’s on TV right now?”

“I don’t know anything,” he replied. “That little piece of shit who just showed up out of nowhere. What the hell is he doing?”

Park Joo-Hyuk frowned.

“How’s the public reacting? Do you know anything?” Cheon Ji-Myung asked.

“I don’t know. I think I have to go down to management and see.”

Park Joo-Hyuk quickly ran up the stairs to management. The office phone lines were burning. People were chaotically running around with documents and taking calls.

“Return fire immediately! This is some bullshit from a crazy nobody who doesn’t know anything!” shouted Lee Chan-Yeol, the executive manager of management. “Send out press releases now! How is the public reacting?”

“They are defending Doctor Ryu so far.”

“Of course they are. It’s all a fxxking conspiracy theory. The CEO has done so much for people. He’s saved so many lives, and this conspiracy theory will blow over. I want you to send out a press release saying that we deny all allegations.”

“Yes, sir.”

The employees pounded away at their keyboards.

* * *

The world was turned upside down, and not just in Korea. It included the United States, where the A-Bio Cancer Laboratory was located, Sweden that gave Young-Joon the highest medal in the country, Mumbai that established a statue of Young-Joon for his work against HIV in Kamathipura, the Congo that was successful in containing the spread of Ebola, along with the International Vaccine Institute and the World Health Organization. It was like a bomb had hit countless countries and organizations.

—This is nonsense. Why would Doctor Ryu harm him?

—An anthrax bioweapon? There’s no evidence of that.

—Doctor Ryu certainly has research capabilities that go beyond conventional knowledge, but why would he make an anthrax bioweapon with his talent?

—How could anyone know what that genius is thinking? Obviously, no one knows why he made a weapon, but Doctor Ryu is receiving extraordinary support from the United States, so that could be a reason.

—This is nonsense. It’s all a conspiracy theory.

—Then, what’s going on in Africa right now? There’s an anthrax epidemic along the anthracis fence. And it’s a respiratory disease!

—Let’s say he didn’t make the anthrax bioweapon. Still, the anthracis fence was a failed strategy. It stopped Ebola, but it created an even worse biological disaster.

—There’s very little known about the anthrax outbreak in Africa because it’s still new. How do we know it was caused by the anthracis fence?

—Then what is it? Anthrax has never caused an epidemic like this before the anthracis fence.

—Everyone blindly trusted him because he was part of the GSC and showed incredible research abilities. That’s why the anthracis fence was done in African countries without much examination. But science should not do that!

—Doctor Ryu has citizenship in Sweden. He can run away any time, so we should suspend his passport at once.

—I think he should be detained. Someone as capable as Doctor Ryu should be able to get rid of the evidence. There’s no one who knows biology better than him.

—Detain? Are you kidding me? Don’t you know what kind of company he is running? He’s practically directing all the research at both A-Gen and A-Bio.

—And that research is right?

—Can research that saves lives be wrong?

—Look at the genetically engineered babies! Look at what Doctor Ryu’s technology has created!

Society was burning. Several intellectuals from all over contributed to the discussion, going for each other’s throats.

In the midst of it all, Yoon Bo-Hyun wrote a column in the newspaper. It was shared thousands of times on the Internet and received a huge number of views.

[The dangers of unprepared technology]

[The technology that Doctor Ryu Young-Joon of A-Bio has presented is truly amazing. The world seems to have moved into the twenty-second century in the blink of an eye. But is that something to celebrate?

Doctor Ryu Young-Joon has given hope to cancer patients by developing Cas9, gene scissors, and he has also created a diagnostic kit.

Recently, however, Doctor He Jiankui from China has used Cas9 to create a genetically engineered baby. Doctor He presented his work at the GSC International conference and was heavily criticized by fellow scientists. There was a divide about this issue, even in the scientific community, which means that even the scientific community, which has developed Cas9, cannot provide ethically safe guidance on this technology.

Many ethicists and religious organizations around the world have raised concerns about genetically engineered babies, and humanity has yet to find an answer. This was science-fiction until yesterday; today, it is a real problem that needs to be addressed immediately.

However, Doctor Ryu is still pushing on the accelerator.

A-Bio is working on a massive project to decode the entire genome of one hundred million humans using more than two hundred genetic analysis machines. This will give him a complete picture of what genes direct what aspects of appearance. He will publish his findings in a paper, which will bring him a lot of fame and money.

But is there any reason for a second He Jiankui to read that paper and not touch those genes?

Doctor Ryu Young-Joon will perfect both gene scissors and high-resolution gene maps, and humanity is not yet ready to accept that. Now is the time to hit the brakes, not the accelerator.]

Amidst the extreme confusion in society, the doctors in charge of the intensive care unit and Yeonyee University Hospital released a statement.

—The patient in question, Kim Hyun-Taek was brought to the hospital unconscious due to brain death.

—We conducted tests for various diseases in the patient’s body, but we have not identified signs of anything, including anthrax.

—Kim Hyun-Taek is not infected with anthrax. We can assure that.

However, this did not touch the public’s heart. People who believed in Young-Joon from the beginning may have been reassured by this announcement. But those who didn’t believe him from the beginning still didn’t because Young-Joon was a genius scientist who conquered many diseases in just one year.

‘He probably manipulated it so that they couldn’t find it.’

It wasn’t scientific, but it was a line of reasoning that was intuitively accepted. Public opinion was still split fifty-fifty.

[The anthracis fence has nothing to do with the bioweapon. The genes in the anthracis fence is the junk DNA of Ebola, and this cannot have any impact on the phenotype of anthracis except for increasing the immunity of the bacteria. The anthracis fence has nothing to do with the current anthrax epidemic.]

Michelle, other African health officials, and the World Health Organization issued a statement.

“But conspiracy theories don’t go away easily,” Yoon Bo-Hyun said.

Yoon Dae-Sung had his eyes closed, and Nicholas was trembling in anger.

“These are people who still believe in the moon landing conspiracy theories in the twenty-first century. There’s also the fan myth[refThe fan myth is a popular misconception in Korea that having an electric fan running in a room while sleeping will kill someone due to the lack of oxygen.[/ref] and the myth that the CIA is spreading the flu to curb population growth. There are quite a lot of people who strongly believe in nonsense like that,” Yoon Bo-Hyun said. “And that’s Ryiu Young-Joon’s weakness. He’s too smart, too perfect, and too moral. He’s too much of an elite, even though all his power comes from the support from the public and most of them are ignorant.”

“...”

“The truth may eventually come out, but not until the two companies merge and elect a CEO.”

“Y—you crazy bastard!”

Nicholas finally lost his cool and grabbed Yoon Bo-Hyun by the neck.

“Do you know what you’ve done?”

“I know! I’m protecting this company instead of my father!” Yoon Bo-Hyun shouted.

“...”

“Division Manager Ji Kwang-Man and Director Kim Hyun-Taek all went down during the battle. My father raised the white flag, but not me.”

Yoon Dae-Sung let out a sigh like he had given up.

“People don’t hate the villain; what they hate are hypocrites. When someone better than you behaves admirably, you respect and follow them, but that doesn’t last long. They change as soon as you give them a few shreds of suspicion, like that person has murderous intentions, or that person has developed a weapon that causes a plague,” Yoon Bo-Hyun said. He added, “Go hide if you can’t fight, but don’t get in my way.”

Nicholas let go of Yoon Bo-Hyun. A silence from exhaustion filled the room.

“Bo-Hyun,” Yoon Dae-Sung said quietly. “You made a big mistake.”

“Do you still think that? Even though I backed him up into a corner like this?”

“The reason that Doctor Ryu is not finishing you off right now is because his priority is the anthrax epidemic in Africa. He doesn’t even consider you his opponent. To him, you’re nothing but a small fruit fly.”

“...”

“You still don’t have an idea of the kind of power he has.”

Yoon Bo-Hyun clenched his jaw.

“Father, I…”

“Does Doctor Ryu just seem like a genius scientist to you? No matter how incredible a scientist is, they can’t make a company like A-Bio in just a year. He’s not good at science; he’s just incredibly intelligent.”

“...”

“I won’t get out now. It would be ridiculous for me to turn myself in and try to find a way to live alone. I will stand by your side, and I will leave with you when you fall, Yoon Dae-Sung said.

Yoon Bo-Hyun stared at him with disappointment.

Nicholas silently agreed with Yoon Dae-Sung. When the anthrax bioweapon came up, Young-Joon would have already figured out that it was something A-Gen had developed in the past. But Young-Joon hadn’t contacted Nicholas yet; he hadn’t asked Nicholas, who had access to all of A-Gen’s research notes, to expose the anthrax bioweapon development because he could destroy Yoon Bo-Hyun without embarrassing Nicholas.

* * *

Young-Joon didn’t leave the country during the talk of him being detained and all that. But there was one person who did get on a plane to the Congo. It was Doctor Messelson. He was reading the email Young-Joon had written the day before.

[The whole genome sequence of the anthracis in Africa is as follows:

ATTGTACTGCTCCATTTACATTGGGGGATCAT…….]

The email attachment contained 5.23 million letters of DNA data. Not only that, it also described what materials were made in each location, how much they were expressed, and what their three-dimensional structure looked like.

‘...’

When he first got this file, Messelson thought Young-Joon had actually designed a bioweapon because it was physically impossible to make something like that overnight.

But he changed his mind after some more thought. He couldn’t have made this data, even if he was the developer—even if he was Young-Joon. This was data that scientists who have worked on anthracis for five to ten years would barely get, which meant that there was a separate scientist who produced this data. In reality, this was the result of using Rosaline, but to Messelson, it seemed like Young-Joon already held the evidence to clear his own name.

“I’m not the one who created the anthrax bioweapon. However, I think it’s true that something like that is going around Africa,” Young-Joon said to Messelson. “I obtained this data through a route I cannot discuss right now, and since it’s a little difficult for me to leave the country now, I am leaving the heavy lifting to you, Doctor Messelson.”

“That’s fine. Leave it to me, Doctor Ryu. I’m the expert on anthracis and bioweapons,” Messelson replied.

And when he was on the plane, Young-Joon held a press conference.

If you find any errors ( Ads popup, ads redirect, broken links, non-standard content, etc.. ), Please let us know < report chapter > so we can fix it as soon as possible.

Tip: You can use left, right, A and D keyboard keys to browse between chapters.